Custom Taqman Sample Clauses

Custom Taqman. SNP genotyping assay to detect the 5HTTLPR polymorphism This assay was adapted from Xxxxxxx et al. (Xxxxxxx, Xxxxxx et al. 2007). 25 ng of DNA was pipetted into a 96-well reaction plate (Applied Biosystems) for inclusion in a total reaction volume of 30 µl. The remaining 25 µl volume of reaction mixture consisted of 200nM of each forward and reverse primer (5’-GCAACCTCCCAGCAACTCCCTGTA-3’ and 5’- GAGGTGCAGGGGGATGCTGGAA-3’ respectively) and 60nM and 120nM of VIC and one FAM labelled probes respectively (all obtained from Applied Biosystems constructed as described in section 2.6.1), 1x Universal PCR Master mix and 1x Q solution. The FAM labelled probe (TGCAGCCCCCCCAGCATCTCCC) is specific to the L allele as it binds to a section of DNA within the 44 bp deletion. The target sequence of the VIC probe (TCCCCCCCTTCACCCCTCGCGGCATCC) is present in both the L and S alleles and serves as a positive internal control. One NTC was included on each plate along with three samples (one of each genotype) for which genotype had been verified by electrophoresis. The following cycling conditions were used: 50°C for 2 minutes, 95°C for 10 minutes then 50 cycles of (98°C for 15 seconds, 62.5°C for 90 seconds). The three genotypes (LL, LS and SS) are differentiated by the level of FAM fluorescence detectable. The authors (Xxxxxxx et al., University of Connecticut) were contacted and agreed to provide their raw ABI SDS output, shown Figure 2-3 with the raw data from this study in shown in Figure 2-4. Figure 2-3 SDS output provided by Xx Xxxxxxxx Xxxxxxx and Xxxxxxxxx Xxxxx (University of Connecticut) Coloured clusters as per A; black dot=undetermined; turquoise dot=NTC; yellow dot=non amplifiers