Roche IP definition

Roche IP means any software or other Intellectual Property (i) owned or licensed by Roche or for which Roche has the right to use or otherwise exploit as of, or prior to, the Effective Date (“Roche Background IP”), or (ii) independently made, conceived or developed solely by Roche, its employees, or persons acting on behalf of Roche, regardless of whether such activity is performed outside of this Agreement (“Roche Solely Developed IP”).
Sample 1Sample 2Sample 3
Roche IP means Know-How and Patent Rights that Roche owns or Controls as of the Effective Date and during the Agreement Term and that relate to Roche Technology. For purposes of clarity, the Patent Rights identified in Appendix 1.68 (“Excluded Patent Rights”) are specifically excluded from the Roche IP.
Sample 1Sample 2Sample 3
Roche IP means all intellectual property (including Patents, Copyrights and Know-How) Controlled by Roche that are necessary or reasonably useful for Recursion’s performance of its Research Plan activities, excluding Program IP and Joint Collaboration IP.
Sample 1

Examples of Roche IP in a sentence

  • After IP with anti-422HA beads (Sigma) for 2 h in the presence of Complete protein inhibitors (Roche) and 40 U423RNase inhibitors (Roche), IP precipitates were processed for Sxl RT-PCR using gene-specifc RT424primer SP NP2 (CATTCCGGATGGCAGAGAATGGGAC) and PCR primers Sxl NP intF425(GAGGGTCAGTCTAAGTTATATTCG) and Sxl NP R3 as described31.

  • Subject to Section 6.2(b), and unless specifically granted otherwise in a Statement of Work, nothing contained in this Agreement shall be construed to grant Dexcom a license to or in any way give ownership to any Roche IP, except that Dexcom shall have access to and the right to use such Roche IP during the Term as required for Dexcom to fulfill, and solely for the purpose of fulfilling, its contractual obligations herein.

  • Roche IP and Joint Inventions: With regard to all Roche IP and any Joint Inventions, Roche shall control, at its sole discretion and expense, the preparation, prosecution and maintenance of all patents and patent applications.

  • Notwithstanding anything to the contrary in this Agreement, each Party will have the right to invoke the CREATE Act when exercising its rights under this Agreement, but with respect to any Patent Rights with the BPM IP or Collaboration Compound IP, only with the prior written consent of BPM in its sole discretion, and with respect to any Patent Rights within the Roche IP, only with the prior written consent of Roche in its sole discretion.

  • Pieris shall remain the owner of Pieris IP, and Roche of Roche IP.

  • Roche grants to Pieris during the Research Term a non-exclusive right and license under Roche IP that are necessary or useful for the discovery, manufacture or development of [***] solely to enable Pieris to perform the activities contemplated under the Research Plan under this Agreement.

  • For purposes of clarity, the Patent Rights identified in Appendix 1.68 (“Excluded Patent Rights”) are specifically excluded from the Roche IP.


More Definitions of Roche IP

Roche IP means all intellectual property owned or Controlled by Roche or its Affiliates after the Effective Date and generated through activities under a Research and Development Program. The term Roche IP shall exclude Joint Patent Rights and Joint KnowHow. [***] Certain information in this document has been excluded pursuant to Regulation S-K, Item 601(b)(10). Such excluded information is not material and would likely cause competitive harm to the registrant if publicly disclosed.
Sample 1
Roche IP means, collectively, the Roche Patents and the Roche Know-How.
Sample 1

Related to Roche IP

  • Licensed IP means the Intellectual Property owned by any person other than the Corporation and to which the Corporation has a license which has not expired or been terminated;

  • Licensee Technology means the Licensee Know-How and Licensee Patents.

  • Licensor Technology means the Licensor Patents, the Licensor Know-How, Licensor Materials, Product IP, and Licensor’s rights in the Program IP and Joint Patents.

  • Foreground IP means all intellectual property and Intellectual Property Rights generated under these Terms; and

  • Licensed Technology means the Licensed Know-How and Licensed Patents.

  • Licensed Patent Rights means:

  • Product Technology means the Product Know-How and Product Patents.

  • Patent Rights means the rights and interests in and to issued patents and pending patent applications (which, for purposes of this Agreement, include certificates of invention, applications for certificates of invention and priority rights) in any country or region, including all provisional applications, substitutions, continuations, continuations-in-part, divisions, renewals, all letters patent granted thereon, and all reissues, re-examinations and extensions thereof, and all foreign counterparts of any of the foregoing.

  • Licensee Patents means all of the Patents Controlled by Licensee, its Sublicensees, or any of its or their respective Affiliates as of the Effective Date or during the Term that are necessary (or, with respect to patent applications, would be necessary if such patent applications were to issue as patents) for the Exploitation of a Licensed Product in the Field in the Territory.

  • Third Party Technology means all Intellectual Property and products owned by third parties and licensed pursuant to Third Party Licenses.

  • Background Technology means all Software, data, know-how, ideas, methodologies, specifications, and other technology in which Contractor owns such Intellectual Property Rights as are necessary for Contractor to grant the rights and licenses set forth in Section 14.1, and for the State (including its licensees, successors and assigns) to exercise such rights and licenses, without violating any right of any Third Party or any Law or incurring any payment obligation to any Third Party. Background Technology must: (a) be identified as Background Technology in the Statement of Work; and (b) have been developed or otherwise acquired by Contractor prior to the date of the Statement of Work, or have been developed by Contractor outside of its performance under the Statement of Work. Background Technology will also include any general consulting tool or methodology created by Contractor, which will not be required to be identified in the Statement of Work.

  • Collaboration IP means Collaboration Know-How and Collaboration Patents.

  • Licensed Patents means (a) all United States patents and patent applications listed in Exhibit A, as modified pursuant to Section 2.6.1, including patents arising from such patent applications; and (b) any re-examination certificates thereof, and their foreign counterparts and extensions, continuations, divisionals, and re-issue applications; provided that “Licensed Patents” will not include any claim of a patent or patent application covering any Manufacturing Technology.

  • Background IP means all IP and IP Rights owned or controlled by Seller prior to the effective date or outside the scope of this Contract.

  • Foreground IPR means any IPRs that are generated as a result of the activities conducted within the framework of the Project concerned as specified in the corresponding Project Agreement;

  • Developed Technology means any Technology including, without limitation, any enhancements, substitutions or improvements to the Core Technology that is (a) discovered, developed or otherwise acquired by DURA pursuant to the terms of the Development Agreement or (b) otherwise acquired by or on behalf of Xxxxxx Corp. II during the term of the Development Agreement.

  • Joint Patent Rights means all Patent Rights claiming a Joint Invention.

  • Product Patents means any Patent Controlled or owned by Quoin in the Territory that, absent the license in Section 2.1, would be infringed by the importation, sale, or use of the Product in the Territory by a third party.

  • Joint Technology means Joint Inventions and Joint Patents.

  • Assigned Patent Rights means all of the following, whether now owned or hereafter acquired or arising:

  • Developed IP means any Intellectual Property Rights that are conceived or reduced to practice, or otherwise created or developed, by or on behalf of a Party, its Affiliates or sublicensees, alone or together with one or more Third Parties, during the Term in connection with the Development, Manufacture, or use of the Compound or any Product.

  • Background IPR means any Intellectual Property Rights (other than Project IPR) belonging to either party before the Commencement Date or not created in the course of or in connection with the Project;

  • Program Patent Rights means all Patent Rights that claim or cover patentable Program Know-How, including any Program-Specific Patent Rights.

  • Regents' Patent Rights means any of the following: the U.S. patent application, serial number [***], entitled [***] disclosing and claiming the Invention, filed by Inventors and assigned to THE REGENTS; and continuing applications thereof including divisions, substitutions, and continuations-in-part (but only to extent the claims thereof are enabled by disclosure of the parent application); any patents issuing on said applications including reissues, reexaminations and extensions; and any corresponding foreign applications or patents.

  • Joint IP means Joint Know-How and Joint Patent Rights.

  • Background Invention means an Invention conceived and first actually reduced to practice before the Effective Date.