Oligonucleotide sequences Sample Clauses

Oligonucleotide sequences. Primer 5’-3’ sequence IQGAP3 Forward ATGGAGTGCTGCTGGCCAAG AttB2 Reverse TTGTACAAGAAAGCTGGG Table 2-5 Sequencing primers siRNA 5’-3’ sequence Company Negative control (non- silencing) AAUUCUCCGAACGUGUCACGU Qiagen, UK Silencer Select (s43270) IQGAP3 siRNA (oligo 1) CAAUGAGGCUCUGGACAAA Thermo Xxxxxx Scientific siGENOME IQGAP3 siRNA (D-009077-02- 0002)(oligo 2) CAAGAUGACUACAGGAUAU Dharmacon Table 2-6 siRNA sequences
AutoNDA by SimpleDocs

Related to Oligonucleotide sequences

  • Hepatitis B Vaccine Where the Hospital identifies high risk areas where employees are exposed to Hepatitis B, the Hospital will provide, at no cost to the employees, a Hepatitis B vaccine.

  • Insulin Insulin will be treated as a prescription drug subject to a separate copay for each type prescribed.

  • Human Leukocyte Antigen Testing This plan covers human leukocyte antigen testing for A, B, and DR antigens once per member per lifetime to establish a member’s bone marrow transplantation donor suitability in accordance with R.I. General Law §27-20-36. The testing must be performed in a facility that is: • accredited by the American Association of Blood Banks or its successors; and • licensed under the Clinical Laboratory Improvement Act as it may be amended from time to time. At the time of testing, the person being tested must complete and sign an informed consent form that also authorizes the results of the test to be used for participation in the National Marrow Donor program.

  • Biological Samples If so specified in the Protocol, Institution and Principal Investigator may collect and provide to Sponsor or its designee Biological Samples (“Biological Samples”). 12.2.

  • Influenza Vaccine Upon recommendation of the Medical Officer of Health, all employees shall be required, on an annual basis to be vaccinated and or to take antiviral medication for influenza. If the costs of such medication are not covered by some other sources, the Employer will pay the cost for such medication. If the employee fails to take the required medication, she may be placed on an unpaid leave of absence during any influenza outbreak in the home until such time as the employee has been cleared by the public health or the Employer to return to the work environment. The only exception to this would be employees for whom taking the medication will result in the employee being physically ill to the extent that she cannot attend work. Upon written direction from the employee’s physician of such medical condition in consultation with the Employer’s physician, (if requested), the employee will be permitted to access their sick bank, if any, during any outbreak period. If there is a dispute between the physicians, the employee will be placed on unpaid leave. If the employee gets sick as a reaction to the drug and applies for WSIB the Employer will not oppose the application. If an employee is pregnant and her physician believes the pregnancy could be in jeopardy as a result of the influenza inoculation and/or the antiviral medication she shall be eligible for sick leave in circumstances where she is not allowed to attend at work as a result of an outbreak. This clause shall be interpreted in a manner consistent with the Ontario Human Rights Code.

  • Unbundled Channelization (Multiplexing) 5.7.1 To the extent NewPhone is purchasing DS1 or DS3 or STS-1 Dedicated Transport pursuant to this Agreement, Unbundled Channelization (UC) provides the optional multiplexing capability that will allow a DS1 (1.544 Mbps) or DS3 (44.736 Mbps) or STS-1 (51.84 Mbps) Network Elements to be multiplexed or channelized at a BellSouth central office. Channelization can be accomplished through the use of a multiplexer or a digital cross-connect system at the discretion of BellSouth. Once UC has been installed, NewPhone may request channel activation on a channelized facility and BellSouth shall connect the requested facilities via COCIs. The COCI must be compatible with the lower capacity facility and ordered with the lower capacity facility. This service is available as defined in NECA 4.

  • Preceptor A per diem Registered Nurse 2 may serve as a preceptor after successfully completing a preceptor workshop or equivalent documented training and agreeing to and being appointed to be specifically responsible for planning, organizing, and evaluating the new skill development of one or more RNs as appropriate enrolled in a defined orientation program, the parameters of which have been set forth in writing by the Employer. This includes teaching, clinical supervision, role modeling, feedback, evaluation (verbal and written) and follow up of the new or transferring employee. The per diem RN 2 preceptor is eligible to receive preceptor premium pay when actually engaged in preceptor role responsibilities with/on behalf of the orienting RN. A per diem RN 2 substituting for the original preceptor during a period of absence and who has been designated to carry out the preceptor's complete responsibility (including following and/or adjusting the plan to meet learning needs and providing oral and written evaluation input) will receive preceptor pay. A preceptor may be assigned to a student when it is determined by the Employer that the employee has completed the required preceptor training or has agreed to and been appointed a preceptor. The employee is specifically responsible for planning, organizing, and evaluating the new skill development of the student as appropriately enrolled in a defined program, the parameters of which have been set forth in writing by the Employer. This includes teaching, clinical supervision, role modeling, feedback, evaluation (verbal and written) and follow up of the student.

  • Program Components Activities and services delivered under this Program Element align with Foundational Programs and Foundational Capabilities, as defined in Oregon’s Public Health Modernization Manual, (xxxx://xxx.xxxxxx.xxx/oha/PH/ABOUT/TASKFORCE/Documents/public_health_modernization_man ual.pdf) as well as with public health accountability outcome and process metrics (if applicable) as follows:

  • RE-WEIGHING PRODUCT Deliveries are subject to re- weighing at the point of destination by the Authorized User. If shrinkage occurs which exceeds that normally allowable in the trade, the Authorized User shall have the option to require delivery of the difference in quantity or to reduce the payment accordingly. Such option shall be exercised in writing by the Authorized User.

  • Treatment Program Testing The Employer may request or require an employee to undergo drug and alcohol testing if the employee has been referred by the employer for chemical dependency treatment or evaluation or is participating in a chemical dependency treatment program under an employee benefit plan, in which case the employee may be requested or required to undergo drug or alcohol testing without prior notice during the evaluation or treatment period and for a period of up to two years following completion of any prescribed chemical dependency treatment program.

Time is Money Join Law Insider Premium to draft better contracts faster.