Taqman qPCR Sample Clauses

Taqman qPCR. 200ng-1μg of RNA was reverse transcribed in an Eppendorf™ Mastercycler Gradient thermocycler using the High capacity reverse transcription Kit (Applied Biosystems) according to the manufacturer’s instructions (RT was primed by random hexamers supplied) in a nuclease-free 96-well low profile PCR plate (Thermo, Xxxxxxx Scientific). cDNA was diluted in 3 volumes of nuclease free H2O (optimal dilution determined previously by Xx Xxxxx Xxxxxxx) and stored at -20ºC or used directly in a qRT-PCR assay. Relative gene expression was performed using commercially available Taqman™ gene expression hydrolysis probe sets. The WFDC1 Taqman™ gene expression assay was custom designed by submission of a 3’ based amplicon (exons 4-6) to the Applied Biosystems Assays-by-Design™ service, using the Filebuilder 3.0™ software (Applied Biosystems) with the resulting assay spanning exon boundaries (>1Kb intronic sequence) to avoid genomic DNA contamination and showed results matching previous qRT-PCR and RT-PCR assays described previously(Xxxxxxx et al., 2008). Assay sequences FWD: 5’ TCGCCCATCTGCTTGC 3’, probe 5’ FAM- GAGTCACCTTCTGGATATTCTTTGTAAAGT -NFQ 3’, REV: 5’ GTGGGCAGTGCGTCAAG 3’. XXXXX was employed as a reference gene. Previous members of the laboratory had optimised the assay using time course gene expression studies with an index of multiple reference genes to validate results (β- actin, GAPDH, HPRT) and the experiments contained within this thesis used GAPDH as a reference gene as previous data had suggested this remains most stable under various tested treatments. Data analysis was performed using the SDS 2.3 Relative quantification software (Applied Biosystems) according to the manufacturer’s instructions and the ΔΔCt method of relative quantification (ABI prism 7700 SDS User Bulletin 2-Applied Biosystems). However, relative copy number was also calculated to assess levels of transcripts using the 2-ΔCt method. Cycling conditions were set according to Taqman™ gene expression assays protocol (Applied Biosystems catalogue ref: p/n4333458) in a 10ul final volume containing 5ul dilute cDNA, 4.5ul Taqman™ universal PCR mix 141 with AMPErase (Applied Biosystems) and 0.5ul primer/probe Taqman™ gene expression assay (Applied Biosystems). RT-PCR, no template, inter-run calibrating and positive/negative controls were run routinely in a 384-well optical plate (Applied Biosystems) and optical adhesive film (Applied Biosystems). All reactions were set up in UV irradiated Laminar fl...
AutoNDA by SimpleDocs

Related to Taqman qPCR

  • Human Leukocyte Antigen Testing This plan covers human leukocyte antigen testing for A, B, and DR antigens once per member per lifetime to establish a member’s bone marrow transplantation donor suitability in accordance with R.I. General Law §27-20-36. The testing must be performed in a facility that is: • accredited by the American Association of Blood Banks or its successors; and • licensed under the Clinical Laboratory Improvement Act as it may be amended from time to time. At the time of testing, the person being tested must complete and sign an informed consent form that also authorizes the results of the test to be used for participation in the National Marrow Donor program.

  • Nepotism No employee shall be directly supervised by a member of his/her immediate family. “

  • Hepatitis B Vaccine Where the Hospital identifies high risk areas where employees are exposed to Hepatitis B, the Hospital will provide, at no cost to the employees, a Hepatitis B vaccine.

  • Mentor Teacher A. Each bargaining unit member in his/her first three (3) years in the classroom shall be assigned a Mentor Teacher by the Administration after consultation with the Association as identified in (Section 1526 of PA 335 (1993)). The Mentor Teacher shall be available to provide professional support, instruction and guidance. The purpose of the mentor assignment is to provide a peer who can offer assistance, resources and information in a non-threatening collegial fashion. B. Mentor Teachers shall be assigned in accordance with the following: 1. The ultimate and overriding criteria used in selecting a Mentor Teacher will be the candidate's recognition as a teacher skilled in the art and science of teaching with the capability to communicate these two areas. 2. The Mentor Teacher shall be a tenured teacher within the bargaining unit whenever possible. 3. Participation as a Mentor Teacher shall be voluntary. 4. The District shall notify the Association of those members requiring a mentor assignment. 5. Mentor Teachers and Mentees shall work in the same building and have the same or similar area of certification whenever possible. 6. The Mentee shall be assigned to only one (1) Mentor Teacher at a time. 7. The Mentor Teacher assignment shall be for one (1) year, subject to review by the Administration, Mentor Teacher and Mentee after three (3) months. The appointment may be renewed in succeeding years. 8. Mentor Teachers may have up to two (2) Mentees if mutually desired by the Mentor Teacher and building principal. C. Because the purpose of the mentor/mentee match is to acclimate the bargaining unit member and to provide necessary assistance toward the end of quality instruction, the Board and the Association agree the relationship shall be confidential. D. Upon approval of the building principal, reasonable release time may be made available so the Mentor Teacher may work with the Mentee in his/her assignment during the regular work day and school calendar year. Where possible, the Mentor Teacher and Mentee shall be assigned common preparation time. E. Mentees shall be provided with a minimum of fifteen (15) days of professional development activities during their first three (3) years of classroom teaching. Professional development shall be scheduled within the parameters of PA 335 and Article XII of this Agreement.

  • Influenza Vaccine Upon recommendation of the Medical Officer of Health, all employees shall be required, on an annual basis to be vaccinated and or to take antiviral medication for influenza. If the costs of such medication are not covered by some other sources, the Employer will pay the cost for such medication. If the employee fails to take the required medication, she may be placed on an unpaid leave of absence during any influenza outbreak in the home until such time as the employee has been cleared by the public health or the Employer to return to the work environment. The only exception to this would be employees for whom taking the medication will result in the employee being physically ill to the extent that she cannot attend work. Upon written direction from the employee’s physician of such medical condition in consultation with the Employer’s physician, (if requested), the employee will be permitted to access their sick bank, if any, during any outbreak period. If there is a dispute between the physicians, the employee will be placed on unpaid leave. If the employee gets sick as a reaction to the drug and applies for WSIB the Employer will not oppose the application. If an employee is pregnant and her physician believes the pregnancy could be in jeopardy as a result of the influenza inoculation and/or the antiviral medication she shall be eligible for sick leave in circumstances where she is not allowed to attend at work as a result of an outbreak. This clause shall be interpreted in a manner consistent with the Ontario Human Rights Code.

  • COVID-19 Vaccine Passports Pursuant to Texas Health and Safety Code, Section 161.0085(c), Contractor certifies that it does not require its customers to provide any documentation certifying the customer’s COVID-19 vaccination or post-transmission recovery on entry to, to gain access to, or to receive service from the Contractor’s business. Contractor acknowledges that such a vaccine or recovery requirement would make Contractor ineligible for a state-funded contract.

  • DUŠEVNÍ VLASTNICTVÍ a) The Institution and the Investigator acknowledge and agree that the Sponsor shall have exclusive ownership rights to all Study Data, Study results, information, improvements, developments, discoveries, inventions, work, know-how and other rights (whether or not patentable), created, developed, and/or reduced to practice as a result of or in connection with the conduct of the Study and/or the use of the Study Drug or the Confidential Information, together with all intellectual property rights (existing and future) relating thereto (“Intellectual Property”) conceived by the Institution or the Investigator or Study Personnel, solely or jointly with others as a result of work done under this Agreement, to the widest extent possible under applicable law. The Institution and the Investigator shall promptly disclose in writing to PSI and the Sponsor all Intellectual Property made or reduced to practice by the Institution, the Investigator and/or the Study Personnel related to the Study. At the Sponsor's request, the Institution and the Investigator shall cause all rights titles and interests in and to any such Intellectual Property to be assigned to the Sponsor without additional compensation and provide reasonable assistance to obtain patents, including causing the execution of any invention assignment or other documents. b) All parties to this Agreement and Sponsor shall retain all right, title and interest in any Intellectual Property that was owned by such party or Sponsor prior to or apart from the commencement of this Agreement. No a) Zdravotnické zařízení a Hlavní zkoušející uznávají a souhlasí, že Zadavatel bude mít výhradní vlastnická práva ke všem Studijním údajům, výsledkům Studie, informacím, vylepšením, na vývoj, k objevům, vynálezům, dílům, know-how a dalším právům (ať už patentovatelným či nikoli), vytvořeným, vyvinutým, a/nebo uvedeným do praxe v důsledku nebo v souvislosti s prováděním Studie, a/nebo používáním Studijního léku nebo Důvěrných informací společně s právy duševního vlastnictví (stávajícími i budoucími) s nimi souvisejícími (dále jen „Duševní vlastnictví“), které vytvořilo Zdravotnické zařízení, Hlavní zkoušející nebo Studijní personál, samostatně nebo společně s ostatními jako výsledek práce prováděné na základě této Smlouvy, a to v největším možném rozsahu povoleném příslušnými zákonnými předpisy. Zdravotnické zařízení a Hlavní zkoušející budou neprodleně písemně informovat PSI a Zadavatele o veškerém Duševním vlastnictví vytvořeném nebo uvedeném do praxe Zdravotnickým zařízením, Hlavním zkoušejícím a/nebo Studijním personálem v souvislosti se Studií. Na žádost Zadavatele zajistí Zdravotnické zařízení a Hlavní zkoušející převod veškerých práv a zájmů týkajících se Duševního vlastnictví na Zadavatele bez další odměny a poskytnou přiměřenou součinnost k získání patentu včetně zajištění podpisu dokumentů k převodu objevu nebo jiných dokumentů. b) Všechny strany této Smlouvy a Zadavatel si i nadále ponechají veškerá práva, nároky a podíly na jakémkoli Duševním vlastnictví, které daná strana nebo Zadavatel vlastnili před začátkem platnosti této Smlouvy nebo na které license grant or assignment, express or implied, by estoppel or otherwise, is intended by, or shall be inferred from, this Agreement except to the extent necessary for each party to fulfill its obligations under this Agreement or otherwise give effect to this Agreement.

  • Vlastnictví Zdravotnické zařízení si ponechá a bude uchovávat Zdravotní záznamy. Zdravotnické zařízení a Zkoušející převedou na Zadavatele veškerá svá práva, nároky a tituly, včetně práv duševního vlastnictví k Důvěrným informacím (ve smyslu níže uvedeném) a k jakýmkoli jiným Studijním datům a údajům.

  • Mentor Teachers A. A Mentor Teacher shall be defined as a Master Teacher as identified in Section 1526 of the School Code and shall perform the duties of a Master Teacher as specified in the School Code and State Administrative Rules and Regulations. B. Each bargaining unit member in his/her first three (3) years in the classroom shall be assigned one or more Mentor Teacher(s) by the Administration. The Mentor Teacher shall be available to provide professional support, instruction and guidance. The purpose of the mentor assignment is to provide a peer who can offer assistance, resources and information in a collegial fashion. C. A Mentor Teacher shall be assigned in accordance with the following: 1. Participation as a Mentor Teacher shall be voluntary. 2. The Mentor Teacher assignment shall be for one (1) academic year subject to review. The appointment may be renewed in succeeding academic years. 3. Should either the Mentor Teacher or the Mentee present cause to dissolve the relationship, the administration will meet with the Mentor Teacher and the Mentee to determine an appropriate course of action. D. Upon request, the Administration may provide release time so the Mentor may work with the Mentee in his/her assignment during the regular work day. E. Mentees who are new to the profession shall be provided with a minimum of fifteen (15) days of professional development instruction during their first three (3) years of classroom teaching. F. Performance responsibilities of a Mentor Teacher may include but not be limited to: Work to establish a relationship with Mentee based on mutual trust, respect and collegiality; provide encouragement, support, guidance and feedback when needed; help Mentee feel welcome; take part in training to enhance teaching and mentoring skills; complete periodic evaluations of Mentor-Mentee program, as requested; contact mentees, minimally once a week, for formal or informal meetings; help Mentee learn about resources, procedures, curriculum, students' needs, building and district policies, regulations and schedules; promote a smooth transition between teacher training and the actual classroom setting; facilitate three-way conferences involving the Mentor, Mentee and Principal; provide opportunities for Mentee to observe the Mentor and other teachers; share new and alternative materials, methods and resources with Mentee; observe Mentee's teaching in a classroom setting; conduct pre and post observation conferences; and assist Mentee with goal setting.

  • Multi-year Planning Targets Schedule A may reflect an allocation for the first Funding Year of this Agreement as well as planning targets for up to two additional years, consistent with the term of this Agreement. In such an event, the HSP acknowledges that if it is provided with planning targets, these targets: a. are targets only, b. are provided solely for the purposes of planning, c. are subject to confirmation, and d. may be changed at the discretion of the Funder in consultation with the HSP. The HSP will proactively manage the risks associated with multi-year planning and the potential changes to the planning targets; and the Funder agrees that it will communicate any changes to the planning targets as soon as reasonably possible.

Draft better contracts in just 5 minutes Get the weekly Law Insider newsletter packed with expert videos, webinars, ebooks, and more!