Taqman qPCR Sample Clauses

Taqman qPCR. 200ng-1μg of RNA was reverse transcribed in an Eppendorf™ Mastercycler Gradient thermocycler using the High capacity reverse transcription Kit (Applied Biosystems) according to the manufacturer’s instructions (RT was primed by random hexamers supplied) in a nuclease-free 96-well low profile PCR plate (Thermo, Xxxxxxx Scientific). cDNA was diluted in 3 volumes of nuclease free H2O (optimal dilution determined previously by Xx Xxxxx Xxxxxxx) and stored at -20ºC or used directly in a qRT-PCR assay. Relative gene expression was performed using commercially available Taqman™ gene expression hydrolysis probe sets. The WFDC1 Taqman™ gene expression assay was custom designed by submission of a 3’ based amplicon (exons 4-6) to the Applied Biosystems Assays-by-Design™ service, using the Filebuilder 3.0™ software (Applied Biosystems) with the resulting assay spanning exon boundaries (>1Kb intronic sequence) to avoid genomic DNA contamination and showed results matching previous qRT-PCR and RT-PCR assays described previously(Xxxxxxx et al., 2008). Assay sequences FWD: 5’ TCGCCCATCTGCTTGC 3’, probe 5’ FAM- GAGTCACCTTCTGGATATTCTTTGTAAAGT -NFQ 3’, REV: 5’ GTGGGCAGTGCGTCAAG 3’. XXXXX was employed as a reference gene. Previous members of the laboratory had optimised the assay using time course gene expression studies with an index of multiple reference genes to validate results (β- actin, GAPDH, HPRT) and the experiments contained within this thesis used GAPDH as a reference gene as previous data had suggested this remains most stable under various tested treatments. Data analysis was performed using the SDS 2.3 Relative quantification software (Applied Biosystems) according to the manufacturer’s instructions and the ΔΔCt method of relative quantification (ABI prism 7700 SDS User Bulletin 2-Applied Biosystems). However, relative copy number was also calculated to assess levels of transcripts using the 2-ΔCt method. Cycling conditions were set according to Taqman™ gene expression assays protocol (Applied Biosystems catalogue ref: p/n4333458) in a 10ul final volume containing 5ul dilute cDNA, 4.5ul Taqman™ universal PCR mix 141 with AMPErase (Applied Biosystems) and 0.5ul primer/probe Taqman™ gene expression assay (Applied Biosystems). RT-PCR, no template, inter-run calibrating and positive/negative controls were run routinely in a 384-well optical plate (Applied Biosystems) and optical adhesive film (Applied Biosystems). All reactions were set up in UV irradiated Laminar fl...
AutoNDA by SimpleDocs

Related to Taqman qPCR

  • Human Leukocyte Antigen Testing This plan covers human leukocyte antigen testing for A, B, and DR antigens once per member per lifetime to establish a member’s bone marrow transplantation donor suitability in accordance with R.I. General Law §27-20-36. The testing must be performed in a facility that is: • accredited by the American Association of Blood Banks or its successors; and • licensed under the Clinical Laboratory Improvement Act as it may be amended from time to time. At the time of testing, the person being tested must complete and sign an informed consent form that also authorizes the results of the test to be used for participation in the National Marrow Donor program.

  • Nepotism No employee shall be awarded a position where he/she is to be directly supervised by a member of his/her immediate family. “

  • STATEWIDE ACHIEVEMENT TESTING When CONTRACTOR is an NPS, per implementation of Senate Bill 484, CONTRACTOR shall administer all Statewide assessments within the California Assessment of Student Performance and Progress (“CAASP”), Desired Results Developmental Profile (“DRDP”), California Alternative Assessment (“CAA”), achievement and abilities tests (using LEA-authorized assessment instruments), the Fitness Gram with the exception of the English Language Proficiency Assessments for California (“ELPAC”) to be completed by the LEA, and as appropriate to the student, and mandated by XXX xxxxxxxx to LEA and state and federal guidelines. CONTRACTOR is subject to the alternative accountability system developed pursuant to Education Code section 52052, in the same manner as public schools. Each LEA student placed with CONTRACTOR by the LEA shall be tested by qualified staff of CONTRACTOR in accordance with that accountability program. XXX shall provide test administration training to CONTRACTOR’S qualified staff. CONTRACTOR shall attend LEA test training and comply with completion of all coding requirements as required by XXX.

  • Preceptor Differential The Hospital shall pay a differential of $1.50 per hour to a nurse who is designated by nursing management to serve as a preceptor to provide on-the-job training to newly hired nurses. One differential will be paid per shift per orientee to the primary preceptor for all hours served as the primary preceptor for that shift. Preceptor will only be paid while the newly hired nurse is in a one-to-one status. Preceptor is a voluntary assignment and the nurse has the option to refuse the preceptor assignment.

  • Hepatitis B Vaccine Where the Hospital identifies high risk areas where employees are exposed to Hepatitis B, the Hospital will provide, at no cost to the employees, a Hepatitis B vaccine.

  • Step No 1 – Any regular employee who has a grievance shall present the grievance verbally to his Supervisor and will be accompanied by a Xxxxxxx. The Supervisor shall state his decision verbally within three (3) working days of such meeting. If this verbal decision does not satisfactorily adjust the grievance, it may be appealed to Step 2 following. Step No. 2 – Notice of appeal must be made within seven (7) working days of the verbal decision, in writing, in triplicate, on forms supplied by the Union, and signed by the aggrieved employee and two members of the Grievance Committee. It shall be appropriately dated showing the date of the grievance, particulars of the incident giving rise to the grievance, the Article and Section of the Collective Agreement alleged to have been violated, the date of the submission, as well as the corrective action requested of the Company, and shall be presented to local management designated to handle Step 2. Within five (5) working days of receipt of the appeal or within any agreed upon extension, local management designated to handle Step 2 will meet with up to two (2) members of the Grievance Committee in an attempt to resolve the grievance. A written decision shall be given by local management designated to handle Step 2 within five (5) working days of the date of such meeting. If this written decision does not satisfactorily adjust the grievance, it may be appealed to Step 3 following. Step No. 3 – Notice of appeal must be given in writing by dating and signing the grievance forms within ten (10) working days from the written decision of local management, or their designate, through the Manager, Labour and Employment Relations, setting forth the areas or points of disagreement with the Step 2 written decision. The Manager, Labour and Employment Relations, will arrange a Management Committee to meet with up to two (2) members of the Grievance Committee and the Local President, or Bargaining Unit Chairperson, or his/her designated alternate, within seven (7) working days or a time mutually agreed upon. The two committees jointly will discuss the grievance and may request the attendance of any person or persons interested or involved. The Management Committee will render its decision in writing within seven (7) working days from the date of such meeting to the Local or Bargaining Unit. If the Committee’s decision does not bring about a satisfactory settlement, the grievance may be referred by either party to arbitration as provided for in Article 8.

  • Influenza Vaccine Upon recommendation of the Medical Officer of Health, all employees shall be required, on an annual basis to be vaccinated and or to take antiviral medication for influenza. If the costs of such medication are not covered by some other sources, the Employer will pay the cost for such medication. If the employee fails to take the required medication, she may be placed on an unpaid leave of absence during any influenza outbreak in the home until such time as the employee has been cleared by the public health or the Employer to return to the work environment. The only exception to this would be employees for whom taking the medication will result in the employee being physically ill to the extent that she cannot attend work. Upon written direction from the employee’s physician of such medical condition in consultation with the Employer’s physician, (if requested), the employee will be permitted to access their sick bank, if any, during any outbreak period. If there is a dispute between the physicians, the employee will be placed on unpaid leave. If the employee gets sick as a reaction to the drug and applies for WSIB the Employer will not oppose the application. If an employee is pregnant and her physician believes the pregnancy could be in jeopardy as a result of the influenza inoculation and/or the antiviral medication she shall be eligible for sick leave in circumstances where she is not allowed to attend at work as a result of an outbreak. This clause shall be interpreted in a manner consistent with the Ontario Human Rights Code.

  • CLASS SIZE/STAFFING LEVELS The board will make every effort to limit FDK/Grade 1 split grades where feasible. APPENDIX A – RETIREMENT GRATUITIES

  • Influenza Vaccination The parties agree that influenza vaccinations may be beneficial for patients and employees. Upon a recommendation pertaining to a facility or a specifically designated area(s) thereof from the Medical Officer of Health or in compliance with applicable provincial legislation, the following rules will apply:

  • Multi-year Planning Targets Schedule A may reflect an allocation for the first Funding Year of this Agreement as well as planning targets for up to two additional years, consistent with the term of this Agreement. In such an event, the HSP acknowledges that if it is provided with planning targets, these targets:

Time is Money Join Law Insider Premium to draft better contracts faster.