Mitochondrial DNA. Sixteen unique mitochondrial haplotypes were identified from the 182 raccoons sampled in northeastern Ohio (Table 2.4). Table 2.4 Definition of 16 unique mitochondrial haplotypes found in 182 raccoons in northeastern Ohio. Polymorphic sites contributing to haplotype definitions are shown with individual site numbers listed vertically. 000122222222222222222222222222222222222222233333333333444 669305666666677777777778888888888999999999903334778999355 127502345678901234567890123456789012345678997892120128727 OH1 AGTCCAAACACCTACATATCAAATACCCACTGCACCACCCCATT-AGGATCGGCAGA OH2 G OH3 ................................................G G OH4 ...A.............................................C...T..G OH5 ...........................................C G OH6 GAC..G..........................................X.X.XX..G OH7 GA...G. G.T.ATG.G OH8 GA...G.................C......................AA..TAAT..G OH9gap GA...G- ....G X.XX..G OH10 GA...G. G.T..T..G OH11 GA..TG. X.XX.XX OH12 GA...G..........................................X.X.XX..G OH13 GA...G............................................X.XX..G OH13gap GA...G- OH14gap GA...G- OH15gap GA...G- .........X.XX..G ...T...X.X.XX..G A.T...X.X.XX..G No double peaks which might be indicative of nuclear copies of mitochondrial DNA (numts) were observed. Of 460 aligned sites, 57 sites were variable. A single nucleotide insertion was found in 2 haplotypes. In addition, 3 haplotypes possessed a 35 bp deletion and another haplotype contained a 36 bp deletion. For the purpose of nucleotide diversity calculations and subsequent analyses, the 35 bp gap was treated as a single evolutionary event. The most common haplotype in the region, OH12, was identified as the probable ancestral haplotype (Figure 2.4). OH13gap most likely gave rise to the other haplotypes containing insertion/deletion events. Spatial structuring within the area was observed for some of the less frequently sampled mitochondrial haplotypes whereas a large amount of overlap was observed in the distributions of those that were encountered more frequently. Haplotype diversity was moderately high (0.8238 ± 0.0159) whereas nucleotide diversity was relatively low (0.0091 ± 0.0051) suggesting that most of the haplotypes in the region differed only by a few nucleotides (Figure 2.4). If multiple populations had been present, one might have expected to observe spatially segregated, distinct haplotype lineages with varying haplotype frequencies, and perhaps potential differences in RRV...
Mitochondrial DNA. Ninety-two distinct mitochondrial haplotypes were identified (Figure 3.5). No double peaks, which might be indicative of nuclear copies of DNA (numts), were observed. Of 440 aligned nucleotides, 71 sites were polymorphic. Haplotype diversity was relatively high (0.8692 ± 0.0304) whereas nucleotide diversity was low (0.0139 ± 0.0073; Table 3.4). The majority of haplotypes differed by a small number of substitutions, although a 35 bp deletion was present in 4 separate haplotypes found in the northeastern part of the study area. Furthermore, one haplotype not containing the deletion event contained an additional 36 bp insertion. For all population genetic analyses, these insertion/deletion events were represented as single evolutionary events. Three main haplotype groups were identified (Figure 3.5), roughly corresponding to the populations described based on the microsatellite results: one consisting of samples from all localities except Florida (I); another group restricted to Ohio, Tennessee, Kentucky, and West Virginia (II); and a final group containing samples from Florida, Georgia, Alabama, and Tennessee (III). All 3 haplotype groups were represented in Tennessee. Most haplotypes were limited in range, although a single nearly cosmopolitan haplotype belonging to haplotype group I was found in every location sampled with the exception of Florida. This particular haplotype was widely distributed and occurred at the highest overall frequency (Figure 3.5), resulting in its identification as the likely ancestral haplotype. OH, WV, VA, KY, TN, NC, SC, GA, AL OH, KY, TN, WV FL, GA, AL, TN Figure 3.5 Distribution of the 3 haplotype groups—states with a single haplotype group are shown with vertical lines; states where 2 haplotype groups occur are shown with dots; all 3 haplotype groups are found in Tennessee, shown in purple. Node size corresponds to relative haplotype frequency. Unsampled haplotypes are shown as small, open circles. Branch lengths correspond to the number of mutational steps between haplotypes. The 4 haplotypes in group I containing a 35 bp deletion event are indicated via a light gray line with a break. Table 3.4 Haplotype and nucleotide diversity indices and neutrality tests. Sample size (n), haplotype diversity (Ĥ), and nucleotide diversity (π). For Chakraborty’s test, the number indicates number of observed alleles (for this test, p < 0.02 is equivalent to p < 0.05). Population 1 2 3 Avg N 218 228 179 208 Ĥ 0.8437±0.0146 0.9633±0.0077 0.80...
Mitochondrial DNA. An approximately 450 base pair (bp) portion of the mitochondrial control region (D loop) was amplified from the previously isolated genomic DNA using primers H16498 (5’-CCTGAACTAGGAACCAGATG-3’) and L15774 (5’- GTAAAACGACGGCCAGTACATGAATTGGAGGACAACCAGT-3’) of Xxxxxxx and Xxxxxx (1991). Polymerase chain reaction (PCR) amplifications were performed in 50 μl volumes containing 500 ng of DNA, 5 μl of 10X Buffer, 4 μl of MgCl2, 2 μl of 10 mM dNTPs, 2.5 μl of each 20 μM primer, and 1.5 U Taq polymerase. Thermal profile conditions consisted of 1 cycle of initial denaturation at 95°C for 10 minutes; 30 cycles of 94°C denaturation for 1 minute, 55°C annealing for 1 minute, and 72°C extension for 1 minute; and a final extension of 72°C for 30 minutes. PCR products were purified with Performa® spin columns (Edge Biosystems, Gaithersburg, Maryland). After cycle- sequencing and additional purification, samples were run on an ABI PRISM® 3100 Genetic Analyzer using BigDye chain terminators (Applied Biosystems, Foster City, California). Sequencher 3.0 software (Gene Codes, Ann Arbor, Michigan) was used to align fragments and to proof nucleotide sequences, and CLUSTAL X (Xxxxxxxx et al. 1997) was used for multiple sequence alignments. Unique haplotypes were determined using Collapse 1.2 (available from xxxx://xxxxxx.xxxxx.xx), and a minimum spanning network of haplotypes was constructed using TCS 1.21 (Xxxxxxx et al. 2000). Haplotype diversity and nucleotide diversity indices were calculated from the data using Arlequin 3.11 software (Excoffier et al. 2005). To test for isolation by distance, a Mantel test was performed with 1,000 permutations using the genetic and geographic distances calculated between all samples in Microsoft Excel with PopTools version 2.7 (Hood 2006).
Mitochondrial DNA. Xxxxxxxx xxxx was generated for an approximately 450 base pair (bp) portion of the mitochondrial control region (D loop) from genomic DNA using the primers H16498 and L15774 (Xxxxxxx and Xxxxxx 1991; see also Chapter 2). Polymerase chain reaction (PCR) amplifications were performed in 50 μl volumes with 500 ng of DNA, 5 μl of 10X Buffer, 4 μl of MgCl2, 2 μl of 10 mM dNTPs, 2.5 μl of each 20 μM primer, and 1.5 U Taq polymerase. Thermal profile conditions consisted of 1 cycle of initial denaturation at 95°C for 10 minutes; 30 cycles of 94°C denaturation for 1 minute, 55°C annealing for 1 minute, and 72°C extension for 1 minute; and a final extension of 72°C for 30 minutes. After cycle-sequencing reactions and additional purification, samples were run on an ABI PRISM® 3100 Genetic Analyzer using BigDye chain terminators (Applied Biosystems, Foster City, California). For analyses based on mitochondrial DNA sequencing, nucleotide fragments were aligned and proofed with Sequencher 3.0 software (Gene Codes, Ann Arbor, Michigan), and a multiple sequence alignment was generated using CLUSTAL X (Xxxxxxxx et al.
