PRIMERS Sample Clauses

PRIMERS. Provide a nonstaining, quick-drying type and consistency recommended by the sealant manufacturer for the particular application.
AutoNDA by SimpleDocs
PRIMERS. Primer sequences were obtained from the original publication using these mice (102). Primers (Sigma-Xxxxxxx; Merck KGaA) were initially diluted to 100µM in AE buffer (Qiagen, Inc.), and then a 10µM working solution was made and stored at -20˚C. Floxed ephrin B2: Forward (a): CTTCAGCAATATACACAGGATG Reverse (b): TGCTTGATTGAAACGAAGCCCGA Reverse (c): AATACTGTTACTACAGGGTCC Cre: Forward: GCCTGCATTACCGGTCGATGCAACGA Reverse: GTGGCAGATGGCGCGGCAACACCATT
PRIMERS. 3 Sealing compound, each type, including compatibility when different sealants are in contact with each other.
PRIMERS. A. Epoxy: 1. Lead free, chrome free, rust inhibitive, two-component epoxy primer specifically designed for use on metal substrates and in conjunction with epoxy grout. The epoxy primer shall be a product of the epoxy grout manufacturer. B. Cementitious Nonshrink: 1. Lead-free, chrome free, rust inhibitive, two-component cementitious non-shrink primer specifically designed for use on metal substrates and in conjunction with cementitious non-shrink grout. The cementitious non-shrink primer shall be a product of the cementitious non-shrink grout manufacturer.
PRIMERS. Primers were synthesised by MWG-Biotech and diluted to a working stock solution of 2 µM. The melting temperature (Tm) is defined as the temperature at which half of the strands are in the double-helical state and half are in the “random-coil” state. Different formulas for calculating Tm have been described in the literature; consequently, Tm varies according to the formula chosen for their calculation. In the present work, Tm were calculated by MWG-Biotech and provided with each oligonucleotide synthesis report (Tm = 69.3 + 0.41 x GC % - 650/length of sequence). The primers used in this work are described in Table 2.1.
PRIMERS to manufacturer's recommendation for specific material, substrate, and end use.

Related to PRIMERS

  • Ergonomics The supervisor/manager will provide training and equipment for staff to safely perform job functions and avoid injury. Employees should contact their supervisor if job procedures, equipment or workstations lead to risk of injury or work-related musculoskeletal disorders. Further ergonomic guidelines shall be referenced on the Environmental Health and Safety website xxx.xxx.xxxxxxxxxx.xxx.

  • Probes Network hosts used to perform (DNS, EPP, etc.) tests (see below) that are located at various global locations.

  • Orthodontics We Cover orthodontics used to help restore oral structures to health and function and to treat serious medical conditions such as: cleft palate and cleft lip; maxillary/mandibular micrognathia (underdeveloped upper or lower jaw); extreme mandibular prognathism; severe asymmetry (craniofacial anomalies); ankylosis of the temporomandibular joint; and other significant skeletal dysplasias.

  • Blasting Blasting shall be permitted only for road construction purposes unless advance permission is obtained from Forest Service. Whenever the Industrial Fire Precaution Level is II or greater, a fire security person equipped with a long handled round point No. 0 or larger shovel and a 5 gallon backpack pump can filled with water, will stay at location of blast for 1 hour after blasting is done. Blasting may be suspended by Forest Service, in areas of high rate of spread and resistance to control. Fuses shall not be used for blasting. Explosive cords shall not be used without permission of Forest Service, which may specify conditions under which such explosives may be used and precautions to be taken.

  • Vaccination and Inoculation ‌ (a) The Employer agrees to take all reasonable precautions to limit the spread of infectious diseases among employees, including in-service seminars for employees. Where the Employer or Occupational Health and Safety Committee identifies high risk areas which expose employees to infectious or communicable diseases for which there are protective immunizations available, such immunizations shall be provided at no cost to the employee. The Committee may consult with the Medical Health Officer. Where the Medical Health Officer identifies such a risk, the immunization shall also be provided at no cost. The Employer shall provide Hepatitis B vaccine, free of charge, to those employees who may be exposed to bodily fluids or other sources of infection. (b) An employee may be required by the Employer, at the request of and at the expense of the Employer, to take a medical examination by a physician of the employee's choice. Employees may be required to take skin tests, x-ray examination, vaccination, and other immunization (with the exception of a rubella vaccination when the employee is of the opinion that a pregnancy is possible), unless the employee's physician has advised in writing that such a procedure may have an adverse effect on the employee's health.

  • Laboratory a. Drug tests shall be conducted by laboratories licensed and approved by SAMSHA which comply with the American Occupational Medical Association (AOMA) ethical standards. Upon advance notice, the parties retain the right to inspect the laboratory to determine conformity with the standards described in this policy. The laboratory will only test for drugs identified in this policy. The City shall bear the cost of all required testing unless otherwise specified herein. b. Tests for all controlled substances, except alcohol, shall be by oral fluid testing and shall consist of two procedures, a screen test and, if that is positive, a confirmation test. c. To be considered positive for reporting by the laboratory to the City, both samples must be tested separately in separate batches and must also show positive results on the confirmatory test. d. In the event of a positive test, the testing laboratory will perform an automatic confirmation test on the original specimen at no cost to the Covered Employee. In addition, the testing laboratory shall preserve a sufficient specimen to permit an independent re-testing at the Covered Employee’s request and expense. The same, or any other, approved laboratory may conduct re-tests. The laboratory shall endeavor to notify the designated MRO of positive drug, alcohol, or adulterant tests results within five (5) working days after receipt of the specimen.

  • Vaccinations Contractor understands, acknowledges, and agrees that, pursuant to Article II of the General Appropriations Act, none of the General Revenue Funds appropriated to the Department of State Health Services (DSHS) may be used for the purpose of promoting or advertising COVID-19 vaccinations in the 2024-25 biennium. It is also the intent of the legislature that to the extent allowed by federal law, any federal funds allocated to DSHS shall be expended for activities other than promoting or advertising COVID-19 vaccinations. Contractor represents and warrants that it is not ineligible, nor will it be ineligible during the term of this Contract, to receive appropriated funding pursuant to Article II.

  • Welding Welding and use of cutting torches or cutoff saws will be permitted only in areas that have been cleared or are free of all material capable of carrying fire. Flammable debris and vegetation must be removed from within a minimum 10-foot radius of all welding and cutting operations. A shovel and a 5-gallon standard backpack water container filled and with handpump attached shall be immediately available for use in the event of a fire start. C8.64 – DEBARMENT AND SUSPENSION CERTIFICATION (3/18). Pursuant to 2 CFR 180 and 2 CFR 417, Purchaser shall certify and obtain certifications from its Subcontractors regarding debarment, suspension, ineligibility, and voluntary exclusion, including additional Subcontractors obtained after award of this contract. “Subcontractors” are participants in lower tier covered transactions. Purchaser may rely upon a certification of a prospective Subcontractor that it is not proposed for debarment under 48 CFR 9.4, debarred, suspended, ineligible, or voluntarily excluded from participating in covered transactions or timber sales, unless Purchaser knows that the certification is erroneous. Purchaser shall keep the certifications of its Subcontractors on file until timber sale Termination Date and any extensions thereof, and will provide a copy at the written request of Contracting Officer. Nothing contained in the foregoing shall be construed to require establishment of a system of records in order to render in good faith the certification required by this Subsection. The knowledge and information of Purchaser is not required to exceed that which is normally possessed by a prudent person in the ordinary course of business dealings. If Purchaser knowingly enters into a timber sale transaction with a person who is proposed for debarment under 48 CFR 9.4, suspended, debarred, ineligible, or voluntarily excluded from participation in covered transactions or timber sales, in addition to other remedies available to the Government, Forest Service may pursue available remedies, including suspension and/or debarment. Contracting Officer shall provide a copy of Forms AD-1047 Certification Regarding Debarment, Suspension and Other Responsibility Matters – Primary Covered Transactions and AD-1048 Certification Regarding Debarment, Suspension, Ineligibility and Voluntary Exclusion – Lower Tier Covered Transactions to the Purchaser. Purchaser shall complete form AD-1047 and provide to the Contracting Officer upon request. Purchaser shall require each subcontractor to complete form AD-1048 and provide to the Contracting Officer upon request.

  • Diagnostic procedures to aid the Provider in determining required dental treatment.

Draft better contracts in just 5 minutes Get the weekly Law Insider newsletter packed with expert videos, webinars, ebooks, and more!